EST details — SGN-E567660

Search information 
Request: 567660Match: SGN-E567660
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C344876Clone name: 11821
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E567660Length: 328 bp (537 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E567660 [] (trimmed) TTCGGTTTCTTACAAAATCTGTCTGTTGCTGTTAACCCAGTTTACTGGCACCCATTCGCTGTGGAAATCTCCTTTATTCCAAATCTCGTTACTTA
ATCTTTCTAATAACATATTCGGGATGGAATTCCCTCCGGCAGGTTAACCCGGTCTGCGTAACTCCAAGTCCGTTGACCTTTACCAACAACAATAT
GACCGGGTGAACTTCCCCTTGAGGTGTATCAGATGACTAACCTTCGACATCTACACCTCGGCGGGGAACTTTTTCCGGTGGGCGCGATTCCTCCG
GAGTATGGAAGGTGTCCCGTCTCTAGGAGTACCTCGCAGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E567660] SGN-U290696 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T368647 [Download][View] Facility Assigned ID: bf_stolxxxx_0010H09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0299 Quality Trim Threshold: 14.5