EST details — SGN-E565728

Search information 
Request: 565728Match: SGN-E565728
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C342297Clone name: 4167
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E565728Length: 357 bp (920 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E565728 [] (trimmed) AACAAGCAGTGATGCAGAGAAGTTCAGATCAGACTTGATGAATATTGCAAGGACTACTTTGAGCTCAAAAATTTTGTCTCAGGACAAGGAGCATT
TTGCAAAACTGGCTGTTGATGCGGTTATGAGGTTAACAGGGAAGTACCAATCTTGAAGCAATCCAGATCATTAAGAAACCTGGAGGGTCATTGAA
CGATTCATTTTTAGACTGACGGGTTTACTTTTGGACAAAAAGATTGGGGTTGGCAACCAAAACGCATAGAACAATGCTAAGATTTTGGTGGCAAA
TACTGCTATGGATACAGATAACAGTCGAAGATATCTGGTGCACCGTGTTCGAGTTGACTCAATGGCCAAGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E565728] SGN-U288164 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T366604 [Download][View] Facility Assigned ID: TBSK03852FA12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0214 Quality Trim Threshold: 14.5