Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E564300

Search information 
Request: 564300Match: SGN-E564300
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C340679Clone name: 2549
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E564300Length: 428 bp (934 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E564300 [] (trimmed) CTTCTATGGCGAGGAAGATCTATTTGAGAGGAGGTATTGGTGTCGGTGGGTTCCCGAAGAATCTATGGTGGTAACCAGAGGAATGGAAGCCGTCC
ACGTCATTTTTGCAAAAGCAGTGGTTCAGTTGCCCGCCACATTCTTCAACAATTGCAGAACATGAACATCATTGACTTTGAGCCTAAGGTGGAAG
GAGGATCACATCCAGTGGCCAGCGGGATCTTGACCACGTTGCTGGAAGAAATGCTGTTGCTTGTTGAGAGAGATGAGTTCATTCCATCTTCTGAA
TACATGAGTTAGTCCAACTTATTGTTTCACGTTTGGACCTCCACTAGATTTACGGGATATGTTCAACTCACAACACTCTGTGGGATGTTTTTTGG
CCTTTCAGAACACTTGTGTCTTTCTCACGTAAAAAAAAAAAAAAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E564300] SGN-U287219 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T364986 [Download][View] Facility Assigned ID: TBSK02174FF02_T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0324 Quality Trim Threshold: 14.5