Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E563422

Search information 
Request: 563422Match: SGN-E563422
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C339993Clone name: 1863
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E563422Length: 226 bp (637 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E563422 [] (trimmed) GGAAGATGAGAAGCCCCAGGTCTCAGTGGATGAGAAGCCCCAGTCTCCACGGAACGCAAAGCCCCCAGCTCTTGGTTGGAAGTCTCAGCGGATGA
AAAGCCCTTGATCTCCGAAAAAGTGAAGCTCGAGGTCTCCGAAGATGAGAAGCCCAGCCGTCTCTTCAGGATGAGAAAGGGCCCCATCTCATCAG
GAAGAGAACTCCCTGGCTCTCAGAACTTGGGTGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E563422] SGN-U293270 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T364300 [Download][View] Facility Assigned ID: TBSK01461FB09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0252 Quality Trim Threshold: 20.5