EST details — SGN-E561894

Search information 
Request: 561894Match: SGN-E561894
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C338282Clone name: 20115
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E561894Length: 314 bp (863 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E561894 [] (trimmed) TCAATTGGGACTGCCAAATGATCAACGTCCTCCACCTTATAAGAAGCCTCATGATCTGAAGAAGGCTTGGAAGGTTGGTGTCCTCACAGCGGTGA
TCAAGCACATCTCCCCTGGATATTGCTANAGATTCGCAAGCTGGTAAGGCAATCGAAGTGCTTGCAGGACAAGATGACAGCGAAGGAAAGTGCAA
CTTGGCTTGCCATCATCAATCAGGAGGAAGTTTTGGCTCGTGAACTTTATCCTGATCGCTGTCCACCTTTGTCCTCAGGTGGTGGTAGTGGAACC
TTCACTATGAATGACAGCAGTGAGTATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E561894] SGN-U268795 Solanum tuberosum Build 4 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T362147 [Download][View] Facility Assigned ID: bf_swstxxxx_0044h03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0230 Quality Trim Threshold: 20.5