Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E552560

Search information 
Request: 552560Match: SGN-E552560
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C331377Clone name: cTSB-4-F1
nocartOrdering Not Available
Library Name: cTSBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E552560Length: 261 bp (1192 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E552560 [] (trimmed) GAAAAGACACTATAATTGTTCAAAGATGTATAGTGCTAGTTTTGTTTGTAAAAACTAGTCATGGTCTTTGAATTATATGCAATTATGGTGCACTA
GACTTATAATTCATGTGGTGTGTTTCTTGTTTTATGCAATATTATGAATAAAATTTTTCATTATAAAAAAAAAAAAAAAAAAAAAAAAAAAACCC
GGGGGGGGGCCCGGTCCCCATTTCCCCCTAAAGGGAGTCTTATTAAATTTCCCGGGCCGTCTTTTTAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E552560] SGN-U593283 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T355148 [Download][View] Facility Assigned ID: ctsb4f1
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.853 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5