EST details — SGN-E551747

Search information 
Request: 551747Match: SGN-E551747
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C330401Clone name: cTSB-1-L17
nocartOrdering Not Available
Library Name: cTSBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551747Length: 274 bp (1239 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551747 [] (trimmed) GCTGAAGAAGGCAGCCCTTGCAAGGTTGAGTGCTGTTCACAGGAGTCTCAAGGTCACCAAGTCAGGTGCCAAGAAGAGGAACCGACAGGCTTAAG
AGTTCATGCTAGGAAATGCTACAGTGTATGACTTGTAATGCATGGGTTTCTCCAGTACCAAAGTTTTGTGTTCGACTTTATCTTTGTTTCTTTCT
GAATTAGCTATTGGCAAGGGCAATCTCTAGTTTTGAGTTTAAAAATGACCTCCTTTATCAGAGCATTAAAAGATTATCTACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551747] SGN-U577252 Tomato 200607 Build 2 56 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T354172 [Download][View] Facility Assigned ID: ctsb1l17
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5