EST details — SGN-E549772

Search information 
Request: 549772Match: SGN-E549772
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169913Clone name: TUS-6-P7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549772Length: 283 bp (798 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E549772 [] (trimmed) ATGGAAACATGTTGTGGTCCGAATATTATTGATAAAGGTTCTACCCAATAGCACTTTGTTTTTCGGGATTATGCAACCCCCAAAAGTCAAAACCA
TATAGGCCGGGGAAAAATTTGCCCTTTACATGATTTTGATACAACCCCCAACCATATAAAAAGGCTTTTTACTTTTAAATCCCCGGCTCTCTCGG
GAAAGGGGCACCCTCTCTTTTTACCAGCTTTATAAATCAACTGTTTACTTACCAGTTCTAAAAATGTTTAAAAACAAAAACTGGCAAAGGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549772] SGN-U602076 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350647 [Download][View] Facility Assigned ID: AGT-284_H07_TUS6#3-H7.T3_059
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0345 Quality Trim Threshold: 14.5