Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E546858

Search information 
Request: 546858Match: SGN-E546858
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194292Clone name: TUS-70-H2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C106773 [cLPP-3-D16] Trace: SGN-T175505 EST: SGN-E363674 Direction: 5' Facility: TIGR
Clone: SGN-C194292 [TUS-70-H2] Trace: SGN-T347734 EST: SGN-E546859 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546858Length: 496 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546858 [] (trimmed) GGGTATGAATAAGTAGCTTAAATTATCATGAGTAGAATAGCGAAGAATCTTTCATGGAATAAAACATCATATGATAAAACAACATAAATTAACAA
TTTGGAACAAGAAGGAGAGCCTCGACTAAAGAACACAACTAATTTGAACACATTAGTGGGAACATTTTCAACACTAAAAACTTGATATAAAGCTC
ACAACTGATCGTGGAAGCATAGAGCTGTCCGATAGGGTCTTTCACTCATCCTCTTCTAGCAAACTCGAAGGTACTGGATGAAAGTCTATTGCCCT
GGCCTCTTTTCTGTACAACCTACTAGAGATGTCTGTCTGAGAAGCTACTACTGAGCTCCCGGTGCATCTCTCATGCTCAAATTCAGACTATTTCG
CATTGTTCGTCTCCCTATACATGGATTTCCTTTGTGCATCATAGTAACCAATTCTCCATAATCAATTCGTCCATCATTGTCCTGATCGACTTCTC
TTATAATATCCACAAAGTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546858] SGN-U580025 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347733 [Download][View] Facility Assigned ID: TUS70H02_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0206 Quality Trim Threshold: 20.5