Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E539631

Search information 
Request: 539631Match: SGN-E539631
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190088Clone name: TUS-59-H22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72677 [cLER-20-O11] Trace: SGN-T96694 EST: SGN-E285122 Direction: 5' Facility: TIGR
Clone: SGN-C190088 [TUS-59-H22] Trace: SGN-T340509 EST: SGN-E539634 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539631Length: 349 bp (890 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539631 [] (trimmed) CCCAAAAAAAATTTAAAAATCTCAAAATTAAGCCAGAATTTTGGAGCATTCACTACAATCTTCAAGTGAAAATTACACTTGATGGAAGAAAATAA
ACACATCCGCTTTCAAACAAGGGGAAAAAATTCCACAACTCATAAGGATCCTTCTAAAGGAAGCGCGATCGCGTATTTCATAAACAAACACACCA
AAACTGCCTTAAGAGGACTAACCAAAGGGTTCCCCGAGCACCCGTAAAATGTACTTCCACTTGGCCCACCTGAAGGTGGAAATGCTTTTATTGAG
CCCCATGCGGGGACTATATAACTTTGTGGACGGTACATCGGACCACCCCCAGATTCACCTGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539631] SGN-U591478 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340506 [Download][View] Facility Assigned ID: TUS59H22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0255 Quality Trim Threshold: 12.5