EST details — SGN-E537744

Search information 
Request: 537744Match: SGN-E537744
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188941Clone name: TUS-56-I3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C49222 [cLEI-7-H8] Trace: SGN-T81216 EST: SGN-E266991 Direction: 5' Facility: TIGR
Clone: SGN-C188941 [TUS-56-I3] Trace: SGN-T338621 EST: SGN-E537746 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537744Length: 448 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E537744 [] (trimmed) ACCAAAGGATTTCAACTTTCTTTTACTAAAACGATGATCGAGTTTTAACTCAAACATCTTTGTATCACCAGGTAACGAACCTGTACTGGATAGTA
GTCAAAGAAAGGTGTGGAAAGGACTACAAAATTTTACATGGAACCCAAGACTAAGTGATCAAATAATTGTCAAGAAGCAACCATCGCCGCTTGGT
AGAGCTTCCAAGAAAGTAAAATTTGAAGTCCCTTAACCACAAAAAATCTGTTGATCTTTCACATTCGGAAGTAACTTTGTAGGGACATGCTCTTA
CGTAACAATGAAAAGATTGTTTTCGTGTCCATCGCTGTGAACAATAGGCCTCAAAGGATCAATCTTCCATATGCCATCAACAACGAACTTGATCT
CATATCTGCCTGGATACAGCTTTAGGCTTACAGAAAAAACACCCGTGCTCGATTTTTCCATCTTTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537744] SGN-U569958 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338619 [Download][View] Facility Assigned ID: TUS56I03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5