Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E537680

Search information 
Request: 537680Match: SGN-E537680
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188904Clone name: TUS-56-G14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48965 [cLEI-6-I12] Trace: SGN-T80750 EST: SGN-E265964 Direction: 5' Facility: TIGR
Clone: SGN-C188904 [TUS-56-G14] Trace: SGN-T348807 EST: SGN-E547932 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537680Length: 411 bp (894 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E537680 [] (trimmed) AAAGGAAAAATACATCATTTTAACTCTCTTGTTTCTTTGACATGAAAAAAAAAAAAAGCAACAACCCTTCAACTTTGACACACTTTCCAATGAAC
TAATAACATCCCAGGGTTCCGTCTTGCATAAAACTTAAACTCAATCAATAAAAAAACCTTTGGAAGGGGGGGATTGCAAAATCCTACCAATCTCA
CATCTTCGACCCCGGGACCCCCCAAGGAACCCGAATTTTCCCCCTTCATATGAAAAAACGGGCCCAAAAACCCCCCTCTTGGGGGGGGGGAAATT
GCGGGGAATCTAAACCTAACCCTTTTGAATCCCCCTTTACCTTTAAATTCATAAGGAAACTGCATATTCCTGCACCCCGGGGGATCCCCTATTTC
TAAAGGGGCCCCCCCCCCGGGGGAACTCCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537680] SGN-U592968 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338555 [Download][View] Facility Assigned ID: TUS56G14_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.866 Expected Error Rate: 0.0174 Quality Trim Threshold: 12.5