EST details — SGN-E534069
| Search information |
| Request: 534069 | Match: SGN-E534069 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C314072 | Clone name: cPHA-16-J12 |
| ||
| Library Name: cPHA | Organism: Petunia hybrida |
Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E534069 | Length: 251 bp (672 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E534069 [] (trimmed)
CTTCCTCACTCTTTCTTTCTCTCTATAACCTCTCTTTCTTTCATCACAACCAAACTCTAGTACAACTCCAAGAAAAGAAAACACACAACAAGAGA
AAGAAGAAGAAGAAAAAAACAAGAGAAAATGATGCTAGGGAAGAGGACAAGGCCACCGATGAAAAGAACAACAAGCATGACAGAAATCACTTTAG
ATCTCAACCTTAATGACCCTGCTGCTACTGCTGCTGCTGCTATGTCTGGTAATTATAATAA
AAGAAGAAGAAGAAAAAAACAAGAGAAAATGATGCTAGGGAAGAGGACAAGGCCACCGATGAAAAGAACAACAAGCATGACAGAAATCACTTTAG
ATCTCAACCTTAATGACCCTGCTGCTACTGCTGCTGCTGCTATGTCTGGTAATTATAATAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E534069] | SGN-U211268 | Petunia hybrida | Build 1 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T326392 [Download][View] | Facility Assigned ID: LIB4113-061-Q6-M1-B12 |
| Submitter: Koni | Sequencing Facility: Monsanto |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.898 | Expected Error Rate: 0.0006 | Quality Trim Threshold: 14.5 |
Working
