EST details — SGN-E530412

Search information 
Request: 530412Match: SGN-E530412
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C316355Clone name: cPHA-3-I17
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E530412Length: 209 bp (750 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E530412 [] (trimmed) AAATAATTCCCCGGTAAGACATAAACTTTTCCTAGAAATCTCATACATACTCTCAAGATGGCATCGTTACGGATTCATTCTAGTGTCCCTCTAGG
CGCATTCAATAAAATTGGGGGCGATTGATGGGGGATTACCATGGTCCGTGCACAAGAATGGTGCACACAGATTTTGCAGTACTCACATTATGCAN
CGGAAGCCTGTTTGTGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E530412] SGN-U209142 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T322365 [Download][View] Facility Assigned ID: LIB4113-010-Q6-M1-A5
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0215 Quality Trim Threshold: 14.5