Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E529260

Search information 
Request: 529260Match: SGN-E529260
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C323161Clone name: Petunia-PP-9-B08
nocartOrdering Not Available
Library Name: Petunia-PPOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E529260Length: 170 bp (982 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E529260 [] (trimmed) TTATCTCCTATAAATGAAAATGAAGTGATGGATGGTGAGAACTCGAGGGGATCTGCTAACAAGGCATCCGGAAGCAGTTGGAATAGCTCCCTTGA
ACAACTGCAGCATTGGCAAATAAACAGGAGAAAACTAGCATTCTCAACAGTGGGCACTCCTGACTATATTGCTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E529260] SGN-U210297 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T332051 [Download][View] Facility Assigned ID: Petunia-PP-9-B08.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0095 Quality Trim Threshold: 20.5