Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E527806

Search information 
Request: 527806Match: SGN-E527806
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C321706Clone name: Petunia-PP-10-A05
nocartOrdering Not Available
Library Name: Petunia-PPOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527806Length: 192 bp (593 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E527806 [] (trimmed) CAAATAGCTTCAAACTTTGATCATTCGTTTGCTTTATTCTTAGTTACAAAATGGCTGATCAGTACGAAACACCAGTTGAGAAAAAGGTTGAAGAG
AACGTTGAGTCTACAGATCGTGGTTTATTTGATTTCCTAGGGAAAAAGGAAGAGGAAAAGCCAACTAGTGCTCAGGAGGAGCAGGCTATTTCCTC
TG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527806] SGN-U210100 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T332132 [Download][View] Facility Assigned ID: Petunia-PP-10-A05.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5