EST details — SGN-E526972
Search information |
Request: 526972 | Match: SGN-E526972 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C327664 | Clone name: PetuniaRF-1-B12 |
| ||
Library Name: Petunia-RF | Organism: Petunia hybrida |
Tissue: whole fruit (ovaries)
Development Stage: several
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E526972 | Length: 264 bp (1063 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E526972 [] (trimmed)
AAAGTGTAAAAGATACATGTCCCAACACCCCAGTATCTTGTGCTGACATTTTAGCAATTGCTGCTCGTGATTCTGTTGTTAAACTAGGAGGACAA
ACCTATAACGTTGCACTGGGAAGAAGAGATGCAAGAACTGCCAATTTCACTGGTGCATTAACTCAACTTCCAGCTCCATTCGACAACCTAACAGT
CCAACTCACAAAATTCAGCGACAAAAATTTCACGGNCCGTGAAATGGTAGCGTTAGTTGGTGCACACACGGTGG
ACCTATAACGTTGCACTGGGAAGAAGAGATGCAAGAACTGCCAATTTCACTGGTGCATTAACTCAACTTCCAGCTCCATTCGACAACCTAACAGT
CCAACTCACAAAATTCAGCGACAAAAATTTCACGGNCCGTGAAATGGTAGCGTTAGTTGGTGCACACACGGTGG
Unigenes |
Current Unigene builds | |||||
[SGN-E526972] | SGN-U209628 | Petunia hybrida | Build 1 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T337418 [Download][View] | Facility Assigned ID: PetuniaRF-1-B12.g |
Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.964 | Expected Error Rate: 0.0112 | Quality Trim Threshold: 14.5 |