Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E526911

Search information 
Request: 526911Match: SGN-E526911
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326656Clone name: PetuniaLF-1-E11
nocartOrdering Not Available
Library Name: Petunia-LFOrganism: Petunia hybrida

Tissue: leaves
Development Stage: various

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526911Length: 386 bp (839 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526911 [] (trimmed) CTGATTCTTGGCCTTTGTGTGACTATTTGTTCTTGATAAGTTCTGAGGCTTTTGCTAGGGAGTTGGCTGAGAATACCGACCAATTGAAATCGGCT
AACAAGAATGAAGCAGCACACGTTGACGGACGTAGTGGATATAATGGCATCGGAGAAGATAGATATTATGGGGGTAAAGGTAAACGTAAAGGTAA
AGGTAAAGGAGGATGCCGTTATGGTTGTTGCAGGAAAGGTTATTACAAAGGTTGCAAGAAATGTTGCTCCTATGCAGGTCAGGCCATGGATAAAG
TCACTGAAACCAATTCTCACAACTGATCATGTAATATAGTGAAATTCTTGTACGTATAGTGGCAAGATGTAATAAGTACTATATAGCTTTCTGTT
GTAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526911] SGN-U211814 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336410 [Download][View] Facility Assigned ID: PetuniaLF-1-E11.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5