EST details — SGN-E523474

Search information 
Request: 523474Match: SGN-E523474
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C321586Clone name: Petunia-resq1-G05
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E523474Length: 365 bp (1067 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E523474 [] (trimmed) CTAGCGCGTGAGCCAATTATCCCCCGTACTGATCGTCCTTTTAAGACGAGCATAGTCTTCGCGCACGATAAAGGGACGAGCGTGTTGTTCAAAGT
GTTGTCCGCGTTTGCGTTTCGTAATATCAGTTTAACAAAGATTGAATCGAGGCCGCATCGTAACCGTCCGATTAGGTTGGTAGATGATGCAAACG
TAGGGACAGCAAAGCATTTTGAGTATATGTTTTATGTGGATTTTGAAGCGTCAATGGCGGACGTAAGAGCACAAAATGCATTGGCTGAAGTTCAG
GAGTTCACGTCTTTTTTAAGGGTGTTGGGTAGTTATCCTATGGATATGACTCCTTGGTCTCCTTCCAGGGATGCTTAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E523474] SGN-U209122 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T331148 [Download][View] Facility Assigned ID: Petunia-resq1-G05.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5