EST details — SGN-E521584
| Search information |
| Request: 521584 | Match: SGN-E521584 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C319792 | Clone name: Petunia-DevA-17-A01 |
| ||
| Library Name: Petunia-DevA | Organism: Petunia hybrida |
Tissue: all floral organs
Development Stage: several
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E521584 | Length: 207 bp (613 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E521584 [] (trimmed)
TGCCACAAGCAGGAACAACATCCAGGTCTATCCTAACTCATGGGCAGCCGTAATGTTGACCTTTGACAATGCAGGAATGTGGAATTTGAGAACAG
AGATGTGGGAAAAATTCTACTTTGGGAGAACAAATGTACTTCAGTGTTCTCTCCCCAGGACGCTCCTTGAGAGACGAGTACAACATCCCTGACAA
CCATCCTCTCTGTGGTG
AGATGTGGGAAAAATTCTACTTTGGGAGAACAAATGTACTTCAGTGTTCTCTCCCCAGGACGCTCCTTGAGAGACGAGTACAACATCCCTGACAA
CCATCCTCTCTGTGGTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E521584] | SGN-U211143 | Petunia hybrida | Build 1 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T329632 [Download][View] | Facility Assigned ID: Petunia-DevA-17R-A01.g |
| Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.963 | Expected Error Rate: 0.0145 | Quality Trim Threshold: 20.5 |
Working
