EST details — SGN-E521449

Search information 
Request: 521449Match: SGN-E521449
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C319657Clone name: Petunia-DevA-15-E10
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E521449Length: 198 bp (565 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E521449 [] (trimmed) ACTAATATTCCAGCATCGTCTATGTACAGCGTGAGATCAGGGCCTAATAGAAGCAGGACAGTGAGTGTATCTGACTCTCCGCTTGCTACGAGCAG
TAATGCTAGTTCTGAAGTGAGTGTTAATAACAATGCTCTGTGTGTGGATGGGATTGAAGCTGATGATGATGTTTACAGCGATAAAGGTGCACGAT
CTCCTGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E521449] SGN-U209490 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T329305 [Download][View] Facility Assigned ID: Petunia-DevA-15-E10.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0047 Quality Trim Threshold: 20.5