EST details — SGN-E520674

Search information 
Request: 520674Match: SGN-E520674
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C318882Clone name: Petunia--E03
nocartOrdering Not Available
Library Name: Petunia-DevAOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E520674Length: 278 bp (419 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E520674 [] (trimmed) CCACCGGAAACACCGCCCCGGACGGAGCTCTAGGCGGCGGAATAGGGTTGCTAGTGGTGGTTCATCAAAGTCTGAGAAACAGGCTTCTGCTGCTG
CAATGTGATGAGTTGTAAATGGTACAAAGGGGAAACTATGCTTGTAAAAATTTCTATACTTATATAGTTGGTGATGTACCAAAAAAATTAGCATA
ATCAGTGGTATAAATACATCAATGTACGTGGTGGTTGGGTGAAAAGTATAAACCTGGTCAATTATTTTTATGAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E520674] SGN-U210275 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T330834 [Download][View] Facility Assigned ID: Petunia--E03.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0059 Quality Trim Threshold: 12.5