EST details — SGN-E518613

Search information 
Request: 518613Match: SGN-E518613
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310630Clone name: cSML-5-L15
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310630 [cSML-5-L15] Trace: SGN-T319485 EST: SGN-E518612 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518613Length: 383 bp (654 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E518613 [] (trimmed) TTTTTTTTCTTTTTTTTTTTCGCGGGAGAATGCGGAATATTGCCTCGTATCATTTAGTTCACACGTTGACTACACGTCTCAGACATAATTGAAGA
CTAAACTAATTTAACCTTAGCAAGTACAGCTCAGTTCCACCACTCCTTTTGAAATTCCAAAACCTCTCCATCAATATCTAGGAATATGCATTTGT
TAGGATGTGAAATAGCAGCTGCCTTTGTCTTCATTGCTGATGAACAGAAGAAACCTTCTCTGCAATTAACTTGATCTGATTCATTCGTTCATCTA
CCAGTTTCTGCAGCAGCTCCTCCACATTACTTTGATTGTCAGTCGTCTCTATGCCACTAGATTCACCATTTCGCGATTTGAACATCACAAATGAC
ATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518613] SGN-U207377 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T319486 [Download][View] Facility Assigned ID: cC-smflcSML5L15d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0198 Quality Trim Threshold: 14.5