Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E517568

Search information 
Request: 517568Match: SGN-E517568
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310072Clone name: cSML-16-J3
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310072 [cSML-16-J3] Trace: SGN-T318442 EST: SGN-E517569 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517568Length: 301 bp (936 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E517568 [] (trimmed) CAAAGGGAGTCCATTGAGTTTGAACTAGATGGACCAGTATGAAAAAGTTGAGAAGATTGGAGAAGGAACGTACGGTGTAGTGTACAAAGCTCGTG
ACCGTGTAACTAATGAGACTATTGCACTGAAGAAAATAAGGCTGGAGCAAGAAGATGAGGGGGTACCAAGCACCGCTATTCGAGAAATCTCTTTC
TTGAAAGAGATGCAACATGCTAATATTGTGAGGTTGCAGGATGTGGTGCACAGTGAAAAGCGATTGTATCTAGTGTTTGAATATCTTGACTTGGA
CTTGAAGAAGCACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517568] SGN-U207201 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318441 [Download][View] Facility Assigned ID: cC-smflcSML16J3c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0143 Quality Trim Threshold: 20.5