Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E517365

Search information 
Request: 517365Match: SGN-E517365
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309959Clone name: cSML-15-N23
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C309959 [cSML-15-N23] Trace: SGN-T318237 EST: SGN-E517364 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517365Length: 436 bp (498 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E517365 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTAAGAATGAGATCTTATCGTACGGGGGAATACATACTTGTAGACCTTGTAAGGGATATTCAATGTAACCATATC
TTTAGTAACAATAACATAACATGAGACGATTAAGATAAAACGGAAATTAAATGTCAGTGGTTTGCATCAGAGCCAGGCAAACCGGCTTTATGCAT
ATCTGCTATAGTCCCGGCTGCTTCTGCAAGATCATTCTTCATCATGGCAACTTTTGATGTAATATACTCTTTATATTTTGAAACAGAATCAACAA
CAGCAAAGAGTTCGCGAGCACACAGCTGCACTTCTTCCTCATTTTGTGCAATTGTTTCCTGCAATTTGGCCTTTGACGCCTTCAGAAAGTCTGCT
GCTTCTCTTTCAACCTGGTCCAACTTCCGAGTTTCTGTTTCAACTTCCTCAACTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517365] SGN-U206516 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318238 [Download][View] Facility Assigned ID: cC-smflcSML15N23d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5