Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E517245

Search information 
Request: 517245Match: SGN-E517245
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309878Clone name: cSML-15-K15
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517245Length: 417 bp (623 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E517245 [] (trimmed) GCAATCTTGCTTCAGTCTTTCCGCAGAACCAATATATTTGCCATGGCAGAATGGGTTGCTTGAAGATACTCTTAGAGCTGCAGGGGTATCGTCAA
GATTAGAGAGTGGCACTAAGGTGTATGTTTCCAACTTGGATGTCGGAGTGACAAATTCAGATATAAGGGAGCTCTTCGCTGAGATGGGTGAACTG
ATACGCTATGCTATCCACTACGACAAAAATGGTCATCCAAGTGGCTCAGCTGAGGTGGTTTTTGCTAGAAGGACTGATGCATATCAAGCACTTAA
AAGATACAACAACGTTCAATTGGATGGGAAGCCAATGAAGATAGAAGTTGTTGCTCCCAAACCAGACATTCCTTTATCAGCTCGTGTAGATGTTG
GACGAGCAAATGGAAGGAGGGCTGTTGTTATGATGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517245] SGN-U206588 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318118 [Download][View] Facility Assigned ID: cC-smflcSML15K15c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5