EST details — SGN-E510461

Search information 
Request: 510461Match: SGN-E510461
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C305123Clone name: KS12022G05
nocartOrdering Not Available
Library Name: KS12Organism: Capsicum annuum

Tissue: Placenta
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E510461Length: 290 bp (933 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E510461 [] (trimmed) CACAAGTTAGTAGTTTGCATATTCATGGCTTCCCACTTCACTTCATCTTCCAGTGTTTGGTTTCTCTTGATTGCTATTGCCTTTGGGCTAAAGTC
GTCCGAGAGTGCAAATATTACCATTATAAACTATTGTAAAGAGACAGTATGGCCTGGAATTACACCTAAAAACAATTTCAGTGGAGATGGTTTTG
AGCTGAAACAAGGCCAGTCTGCTGTTTTTATCGCCCCGGCCGCGTGGAGTGGCCGTATATGGGGTCGAACCGGCTGTGACTTTGACAACAACGAT
AATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E510461] SGN-U205477 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T311827 [Download][View] Facility Assigned ID: KS12022G05
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5