EST details — SGN-E510192

Search information 
Request: 510192Match: SGN-E510192
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C306194Clone name: KS12038H07
nocartOrdering Not Available
Library Name: KS12Organism: Capsicum annuum

Tissue: Placenta
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E510192Length: 340 bp (968 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E510192 [] (trimmed) GCAACCCGATCTTTCGTCTACTTGATCGATCGGGTTTTACTGTTTTCTTTAGTTTGATCGAAGTTTAGGAAGATGTCGAAATTGTATGGAGAGGA
TTTTAATCAGAAGATAGATTATGTGTTCAAGGTGGTGTTGATTGGAGACTCTGCAGTTGGAAAATCCCAGTCATTGGCACGGTCTCCGAGGAACG
AGTTTAGTCTTGATTCTAAGGCGACTATCGGTGTTGAGTTCCAGACGAGGACGTTAGAGATTGATCATAAGACTGTTAAGGCTCAGATTTGGGAC
ACTGCTGGTCACGAGAGATATAGGGCAGTGACAAGTGCGTACTACCGAGGTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E510192] SGN-U204288 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T312898 [Download][View] Facility Assigned ID: KS12038H07
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0241 Quality Trim Threshold: 14.5