EST details — SGN-E506873

Search information 
Request: 506873Match: SGN-E506873
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C296988Clone name: KS10025G09
nocartOrdering Not Available
Library Name: KS10Organism: Capsicum annuum

Tissue: Hairy root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E506873Length: 350 bp (1086 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E506873 [] (trimmed) AGTGAAGGCAATGAAGCACATTCTTGCAAAACCAATCGGGGCCTACGGAAATGGAGGAAAGAAGAGCAGTTCTTGAAATTCTACGAAGCACTAAT
ACTATGGAATGAGGTAAAATAGCAGGCTAACGGAGGATGTTAAAAGAATGCTGGTGCTTGGCTTGACAACCTCGTTGGTGCATTGATTACCAGAC
CTCATTTCCAGCATAAACAAGATTACAATGTTGATTAATGATGTGTATATATTGCTACTGTATTGATCGCGCTGCAACCAGAACATGATTAAAGA
AGGATCATTGTCATACGTTGTCTAATCATCATGTACATAATCCTAGTTCCTTATTATGATGGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E506873] SGN-U199278 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T303692 [Download][View] Facility Assigned ID: KS10025G09
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0197 Quality Trim Threshold: 12.5