Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E500962

Search information 
Request: 500962Match: SGN-E500962
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C293692Clone name: KS08008A06
nocartOrdering Not Available
Library Name: KS08Organism: Capsicum annuum

Tissue: Anther
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E500962Length: 225 bp (841 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E500962 [] (trimmed) CCCCGGGCTGCAGGAATTCGCGGCCGCTAAAAGCAGGTACCCTCACTCTAATTTGGGTCTGTTTCTTCTGATCTTTTATAGTTTTGCTAAGCTTA
GCAATATGCTCTGCCCAGCCACTTGATGTTCGCAAAATTAAGTCTAAGGAAACTGATCATCAGAGTCACAAAGTTAACACTTTGAGTAATGTCGA
TGTCACAGGCTTTGGAGGCATTGGTGGTGGTGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E500962] SGN-U203860 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T300396 [Download][View] Facility Assigned ID: KS08008A06
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0072 Quality Trim Threshold: 20.5