EST details — SGN-E492197

Search information 
Request: 492197Match: SGN-E492197
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C284833Clone name: KS01034G12
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E492197Length: 297 bp (730 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E492197 [] (trimmed) TTATTGTTGTTCAAGAAATGGGGAAGTACATAAGGAAGACAAGAAAGGAGGAGAAGTATACCACTTGGTGTGCTTACAAGGGCAAAAGCTTTAGC
TCTTAAACGTGCACCGTCTGCGGCGGCGGCGGTGGTGAAGGAGGAGGATTCAGGTGGGTCCTACCTAGAGCTGAGGAGTGAGAGGTTGGATAAAC
CCTTTATGGNTCTTGAAGGAAGAAAGCAGAGAAATGGGGTTTCCAAGAATGCTAACCCTAAGGACTGTTTGGCTAAGGAAATGGAAAAGATGAAG
GGAGATGGGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E492197] SGN-U199468 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T291537 [Download][View] Facility Assigned ID: KS01034G12
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0226 Quality Trim Threshold: 20.5