EST details — SGN-E484513

Search information 
Request: 484513Match: SGN-E484513
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C233067Clone name: cSTE-13-L15
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E484513Length: 165 bp (997 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E484513 [] (trimmed) GGGTTGTCTCGCGGTACCCCTGATTCACTCGTGAACTTCAGGGTTGCAAGTAGCATACTTCAGTCAGTGTATTTGGAAATATTGGCAGAGTTAGT
CTACTTTCTCGATAATCTTACAATAGTGAACTTGTCAAGGATCAGTTCAATGTTGCTAGGCAACATATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E484513] SGN-U298708 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T229734 [Download][View] Facility Assigned ID: PTEBY68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0200 Quality Trim Threshold: 20.5