| SGN ID: SGN-C233067 | Clone name: cSTE-13-L15 |  | Ordering Not Available |
|
| Library Name: cSTE | Organism: Solanum tuberosum |
Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E484513 | Length: 165 bp (997 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E484513 [] (trimmed)
GGGTTGTCTCGCGGTACCCCTGATTCACTCGTGAACTTCAGGGTTGCAAGTAGCATACTTCAGTCAGTGTATTTGGAAATATTGGCAGAGTTAGT
CTACTTTCTCGATAATCTTACAATAGTGAACTTGTCAAGGATCAGTTCAATGTTGCTAGGCAACATATCT
[BLAST] [AA Translate]
| SGN-ID: SGN-T229734 [Download][View] |
Facility Assigned ID: PTEBY68TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
| Sequence Entropy: 0.962 |
Expected Error Rate: 0.0200 |
Quality Trim Threshold: 20.5 |