Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E481364

Search information 
Request: 481364Match: SGN-E481364
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C229194Clone name: cSTD-17-N24
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E481364Length: 404 bp (1067 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E481364 [] (trimmed) CTACTTGATAATTCTTCTCTGCTTCCATCATTTTCCAGCACCAGCAGCAGCCATGGTTGCACCAACTAGAGGTCGTGGTGGTGGTGGATTCAGGG
GCGGAAGAGGAGATGGAGGAGGAAGAGGAGGACGAGGTGGTAGAGGTGGTTTCAGTGGTGGAAGAGGGGGTTTCAGTGGTGGAAGAGGGGGTTTT
GGAAGTGGAGGAAGTGGGATGAAGCGAGGAGGAGGTATAGGAGACAGAGGTGGAAGAGGTGGAGGAAGGGGACGTGGAGGAATGAAGGGTGGTAG
TAAGGTTGTGGTGGAGCCTCATAGACATGGAGGCGTGTTCATTGCTAAGGGCAAGGAATATGCTCTTTGTACTAAGAATTTGGTACCTGGTGAAG
CTGTCTACAATGAAAAGAGAATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E481364] SGN-U287291 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T226585 [Download][View] Facility Assigned ID: PTDCP84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5