Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E455632

Search information 
Request: 455632Match: SGN-E455632
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C243028Clone name: cSTS-26-J6
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E455632Length: 260 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E455632 [] (trimmed) TGGAAACAGGAGTTGAGCGGCTTCATGTATTCCCTACATTTCTTGTGGGATTCAAAATTATGGGTGTTGCACTCTCAGGTTTGAAGATAGAAAAA
CTTGATTTCAAGAATCTACCTACACGACCTTATAAAGGATTTCGAGCTCTAACCAGGTCTGGGCAATATGAAGTCAGGTCATAATTCAGTTTTTG
GAAATTGAACTTTTTAGCTATGATTATAAATGGATTTAAGAGCTAATTATCATCATACAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E455632] SGN-U285305 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T241208 [Download][View] Facility Assigned ID: PEYDZ51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0009 Quality Trim Threshold: 12.5