EST details — SGN-E452856

Search information 
Request: 452856Match: SGN-E452856
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C240224Clone name: cSTS-18-M7
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E452856Length: 273 bp (908 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E452856 [] (trimmed) CGGAAGCCTTCTGGATTTTCTACGACAAGTTTCCACCTTTGGACTCTCACTTGTGAGACTTGACATAAGACAAGAGTCGGATCGCCACACTGATG
TCCTTGATGCCATTACCCAGCACTTGGAAATTGGTTCATATCGAGAGTGGTCTGAGGAACGTAGACAAGAGTGGCTTCTCTCTGAACTCAGCGGC
AAGCGACCTCTATTTGGACCCGATCTACCAAAAACTGAAGAAATTGCTGATGTTTTGAATACATTCCATGTCATATCAGAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E452856] SGN-U292831 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T238432 [Download][View] Facility Assigned ID: PEYCQ76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5