| SGN ID: SGN-C212155 | Clone name: cSTA-32-K13 |  | Ordering Not Available |
|
| Library Name: cSTA | Organism: Solanum tuberosum |
Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E442154 | Length: 221 bp (870 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E442154 [] (trimmed)
TGACAACCCACAATTTCTCATAAACCCTTCTTCTTTATTCTCTCTTTTAAAGATCAAAATCGAGGTTCTTCTTGAAATTCATCTTAATTACACAT
GGGCACAATATCTTATAAGTCGGATGATAAATACTCAACTATTACTGATAAAGGAGACATCGGATTTGTCAAATATGACAAATATAAATCAGTTG
GTATCTACAATCCAAATGAATAGAGTGATAT
[BLAST] [AA Translate]
| SGN-ID: SGN-T206795 [Download][View] |
Facility Assigned ID: PSTEU67TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.913 |
Expected Error Rate: 0.0301 |
Quality Trim Threshold: 14.5 |