EST details — SGN-E439311

Search information 
Request: 439311Match: SGN-E439311
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C206865Clone name: cSTA-11-N9
nocartOrdering Not Available
Library Name: cSTAOrganism: Solanum tuberosum

Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E439311Length: 422 bp (869 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E439311 [] (trimmed) CCGATATCTAATTAAACCTGAATGAGCACTTATCACTCAACGACCCTTCCTGTGGTGACACTGTGACAGCAAGAGCCTAGTTAAGACAGCCAACA
TTTGTACCCCTTTTGCTCTCTCTCTCTCTCTCTCTTGCTAGTCTCTGCTCACTTTTCTTCTTCCATTTTCTGCTGATTTTTACACAGAAAAGGAA
AAAAAATATGGCAAGTGGGGGTGGGTATGGTGATGCAAGTCAGAAAATAGACTATGTTTTTAAGGTTGTTTTGATAGGTGATTCAGCTGTGGGAA
AATCTCAAATACTAGCTCGTTTTGCAAGAAATGAGTTTAGTCTTGATTCTAAAGCTACTATTGGTGTTGAATTCCAGACAAGAACACTTGTTATT
CAACGTAAATCTGTTAAAGCTCAGATCTGGGATACTGCTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E439311] SGN-U295435 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T203952 [Download][View] Facility Assigned ID: PSTBQ77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5