EST details — SGN-E430234
| Search information |
| Request: 430234 | Match: SGN-E430234 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C278652 | Clone name: STM-53-I4 |
| ||
| Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C278652 [STM-53-I4] | Trace: SGN-T282372 | EST: SGN-E430235 | Direction: 3' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E430234 | Length: 208 bp (919 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E430234 [] (trimmed)
TCTCTCTCTACAATCCCCTTTCTTCTTTCTTCTGAAAATTGTCAACCCACATTTGAAATCCCAAATTCCAAAAGGGGAAAAAACAGGGTTCACTT
TTGATTTCTCTTTCGCCATGTCTATTCGTAGAAGAACCTTGCTTAAAGTTATCGTCCTTGGCGATAGTGGGGTTGGTAAAACGTCATTAATGAAT
CAATATGTACACAAGAAG
TTGATTTCTCTTTCGCCATGTCTATTCGTAGAAGAACCTTGCTTAAAGTTATCGTCCTTGGCGATAGTGGGGTTGGTAAAACGTCATTAATGAAT
CAATATGTACACAAGAAG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E430234] | SGN-U275062 | Solanum tuberosum | Build 4 | 6 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T282371 [Download][View] | Facility Assigned ID: STMIB50TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.945 | Expected Error Rate: 0.0017 | Quality Trim Threshold: 14.5 |


