EST details — SGN-E427666

Search information 
Request: 427666Match: SGN-E427666
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277077Clone name: STM-48-L4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277077 [STM-48-L4] Trace: SGN-T279802 EST: SGN-E427665 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427666Length: 350 bp (1037 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427666 [] (trimmed) TTTTTTTTTTTTTTTTTTCGATCTCTGCAGAGCTTTGCATTAACAAAACTATAACACATGTATCACAAATTCTTCATAATAAAAAGTTTAGTACC
TAAAGATACAAAGTTTTGTGCTACTGTACTTCGAAAATACGCTACGAAATTTACTCATTTTTTACCAACAAGTATTGATTATCTAGCAGTAGCAG
CACCTTCTTTAAACAGGATATTTGGCCGAAGCCAGGCTGGCTTGCCACCAACCTCACCATCCTTAGTACGATGATCCTTCGAGTCCTTCTTCAGC
TTCGCATTAATGCATTTTCCTACAGATACACCAAGCTTTGCTGCTGTAAGTAGGCTAAACACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427666] SGN-U290426 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279803 [Download][View] Facility Assigned ID: STMHJ62TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0219 Quality Trim Threshold: 20.5