EST details — SGN-E425568

Search information 
Request: 425568Match: SGN-E425568
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275873Clone name: STM-45-C10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275873 [STM-45-C10] Trace: SGN-T277704 EST: SGN-E425567 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E425568Length: 262 bp (936 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E425568 [] (trimmed) TTTCTTTTTTTTAAAAGAAAGGAGCTTTATTTAAGTGAAAGTAAATGTAATAATACTACATCATCCCAATAAGTACAAATTGCATCTCAGAAGAG
GGGATTAAAGTTAAACTCCATCTTAATTAAGAGAGAGATTAAACCCACTCATACATCTCCAAAATAATTAAGCAGATGAGAATACTAGTTAGTTT
ATACTTGATAATTAGTCAAAATGTACACATTTTAAATTGACGTACAAAATAAGGTCACATGAGAGCAATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E425568] SGN-U272195 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T277705 [Download][View] Facility Assigned ID: STMGV17TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5