EST details — SGN-E422029

Search information 
Request: 422029Match: SGN-E422029
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273955Clone name: STM-33-P22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273955 [STM-33-P22] Trace: SGN-T274165 EST: SGN-E422028 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422029Length: 307 bp (862 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E422029 [] (trimmed) TATGACCCATAGTTTAGCCATCATGACTCAGTTCATCTTAGCCCAATTTAAGCTTTGGACAGGGTTGTACATTGGTCCATCTGAGTTGAACCGCA
ACTTCAGCACAACCAACCCATTTTCCACCCCTAAGCAAGACCACAAGCTTGATACGAGAAAATCTGTGCACTTGTAGTTTGTACAAAAATCAAAC
CAAAAGAATTACAATGAAAGTGATTCTGGAAATATAGAAATAAGGAATAGTAATGCACAATAGGCTGCTTATTTGCCTATGGAACGAGCAAACTT
CTCTGGCTACTTGTGGGGGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422029] SGN-U273459 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274166 [Download][View] Facility Assigned ID: STMFB95TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0036 Quality Trim Threshold: 20.5