Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E420637

Search information 
Request: 420637Match: SGN-E420637
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273089Clone name: STM-31-F7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273089 [STM-31-F7] Trace: SGN-T272773 EST: SGN-E420636 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E420637Length: 410 bp (975 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E420637 [] (trimmed) ATATGATTGCTACTTCTTATCAAACATTGTCACAGGCAACAATTAATAACTTAACATTGTTACAAGCAAAATTTAATAACTTAAACGACCATCAA
ACAAGATAATTGCAACCTGTTATTTTCACTCTACAAACACAAGTCTGGTCATCAACTTGGCAAGTACTTAGGTCACATTGAGACCAAGGTTGATT
TTTACTACTAGAATTTGTACAGCAAGCCTAAAAGAAGCATTTCTCTATTGTCTCTGGCCAAAGGGAGAGCTGGAACGGACAGTACTGCGATGGTC
AGGTCTCCCTACTGTCCTGATTGACCTGATCCTGGTTTTGCTTTGTTCCTGAAGTTACCAAGCGAGCTCCAACTCTTCTCTGAATTTGTGTCTGC
ATCCACAAAGTCCATCAGCATACTTTGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E420637] SGN-U289706 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T272774 [Download][View] Facility Assigned ID: STMES28TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0053 Quality Trim Threshold: 20.5