Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E403407

Search information 
Request: 403407Match: SGN-E403407
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C262605Clone name: PPC-10-D21
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E403407Length: 301 bp (800 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E403407 [] (trimmed) CAAAAACTTTATATTATAATTCTTCAATTCTAACAAATGGGTGAAGAAACCAAAGTTGAAGGAGCAGAGAAAAAGAGTGATGGCTCAATTGTTTT
AAAGCTGGATTTGCATTGTGAAGGTTGTGCACAAAAAGTCAGACGATTCATTCGCCATACTCATGGTGTGGAAAAAGTGAAATCAGACTGTGAAA
CTGGAAAATTGACGGTTAAAGGTGACGTGGACCCTTCATGGCTCCGGGAAAGAGTGGAGATCAAAACCAAAAAGAAGGTCGACCTTATATCATCG
CCGCCCAAAAAGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E403407] SGN-U297327 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T260978 [Download][View] Facility Assigned ID: PPCBM23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0000 Quality Trim Threshold: 14.5