EST details — SGN-E401918

Search information 
Request: 401918Match: SGN-E401918
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C265862Clone name: PPC-5-B14
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E401918Length: 244 bp (810 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E401918 [] (trimmed) TTAACTTGGGATGTCGATAACTTATGCTATTTTCCAGTTTTTTCGGACTTGATTCATCTTCCATGCTCCGTGGAATAATTGAATGTAAGCTACTA
CGTACTTGTATATTTGTCATTTTGGTATAGCAAAGTGAGTGAGTTAGTTATCCTGGTAATGTCAACAGAAATTCAACTCTACTTGTAACTTACGT
CATTTATACCTGATAGTCTAATTAAGCATCAATTTTCAACTGAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E401918] SGN-U272831 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T259489 [Download][View] Facility Assigned ID: PPCAT07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5