EST details — SGN-E397386

Search information 
Request: 397386Match: SGN-E397386
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184749Clone name: TUS-45-J11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184749 is on microarray TOM1 spot ID 1-1-6.2.14.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82384 [cLET-1-M15] Trace: SGN-T102408 EST: SGN-E292134 Direction: 5' Facility: TIGR
Clone: SGN-C82384 [cLET-1-M15] Trace: SGN-T102588 EST: SGN-E292314 Direction: 3' Facility: TIGR
Clone: SGN-C184749 [TUS-45-J11] Trace: SGN-T198713 EST: SGN-E397387 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397386Length: 374 bp (902 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397386 [] (trimmed) AAAAATAAAAATTATTTTCTTTTAAAAAAGCTTTTACATACAACTTGATGATAATTTATTTCACATAAATGACATTTGAATTGAAAAAAATACCC
ATTTAAACAAACCCTAAAAAAATAAAAAAAAAATGGTTTGAAACCCTTAACCCCTACCCTTGAATGGAATTGCCCTGAAGATTATTTGATGGAAA
ATTGCACCAAGGGCACCCCCAATGAATGGCCCAAACCAAAAAATCCAATGGTCATCCCAAGCTTGGTCTTGGTTGAAAATGAAAGCACCTCCAAG
GCTCCTAGCAGGGTTGAGGCCATTTCCGGTAATTGGGATGGTCCCCAAAAGAACCCTGAACCCCGCGAATCCAATTGGAACTGGTGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397386] SGN-U593142 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198712 [Download][View] Facility Assigned ID: FA0AAD33CE06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.894 Expected Error Rate: 0.0175 Quality Trim Threshold: 14.5