EST details — SGN-E397255
Search information |
Request: 397255 | Match: SGN-E397255 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C184771 | Clone name: TUS-45-K9 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184771 is on microarray TOM1 spot ID 1-1-8.3.14.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C80368 [cLET-12-A12] | Trace: SGN-T105664 | EST: SGN-E293201 | Direction: 5' | Facility: TIGR |
Clone: SGN-C184771 [TUS-45-K9] | Trace: SGN-T198501 | EST: SGN-E397175 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E397255 | Length: 175 bp (864 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E397255 [] (trimmed)
AAAACCCCCCCCCCCTTATTTTTTAATCCCAAAAAAAAAAAAAAAAACAAAAATGGGATTTTTCCCCCCCCCACGGGTAAAGGGGAAGAAAAAAA
AAAAAAGGGGGAAAGGGGAAAAGGGGGGGGACCGCGGGGTTTTTTTAAAAAAAAATTCCCCCCCCCCGCCTCCGGCCTCT
AAAAAAGGGGGAAAGGGGAAAAGGGGGGGGACCGCGGGGTTTTTTTAAAAAAAAATTCCCCCCCCCCGCCTCCGGCCTCT
Unigenes |
Current Unigene builds | |||||
[SGN-E397255] | SGN-U600731 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T198581 [Download][View] | Facility Assigned ID: FA0AAD33AF05FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.685 | Expected Error Rate: 0.0344 | Quality Trim Threshold: 14.5 |