EST details — SGN-E397238
| Search information |
| Request: 397238 | Match: SGN-E397238 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C184675 | Clone name: TUS-45-G9 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184675 is on microarray TOM1 spot ID 1-1-8.3.14.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C88507 [cLET-8-H21] | Trace: SGN-T104384 | EST: SGN-E290988 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C184675 [TUS-45-G9] | Trace: SGN-T200009 | EST: SGN-E398683 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E397238 | Length: 101 bp (911 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E397238 [] (trimmed)
CATTAGCTGAGATTACTAGTTAGTTTATACTTGATAATTACCTTAAATTTATACAAAGTACAAAATAAGGGTACTTGAGAGCAATTCTTCGGGCA
TAAGGG
TAAGGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E397238] | SGN-U592797 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T198564 [Download][View] | Facility Assigned ID: FA0AAD33AD05FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.835 | Expected Error Rate: 0.0177 | Quality Trim Threshold: 14.5 |


