EST details — SGN-E396173

Search information 
Request: 396173Match: SGN-E396173
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173877Clone name: TUS-17-E11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173877 is on microarray TOM1 spot ID 1-1-6.1.17.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6301 [cLEC-35-A17] Trace: SGN-T30761 EST: SGN-E210413 Direction: 5' Facility: TIGR
Clone: SGN-C173877 [TUS-17-E11] Trace: SGN-T191424 EST: SGN-E390098 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396173Length: 424 bp (916 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396173 [] (trimmed) AAGGCAATTTTAAAGGGGTTAAATAATTTCTTTTTCCCTCCCTAAAAGAGGGGATACTTCCAAAGAAAAATACAAAATACAATATTTTGCCCGTT
TTATGCTTATTCCTACTTGGAAAAAACAGTAAAAAACTCAAGGGGACCCCACTGATTTGCTTCTTCAAAACAAATTATTGTTCTATTTCTTCCCA
TTTGTAACCAAGTACAAAACCCTGATTGCAGCAAGGAAAAACCAGTTGCATTATGAACTCTCTTCTTCTTTGGCTATCTGAAAGGAGGCCTTCAA
GCCCATCGAAAACGGCTTTTTAGCAAAAGAGGTATTGCCCCCGGGTTTGAACCCTCCCAATTCCCTGAAACCTAAAAAGGGTTATTGGGTTAACT
AGATCTAAAGCAAACTTATTCCCCCCCAATGGGGGGGGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396173] SGN-U599246 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197499 [Download][View] Facility Assigned ID: FA0AAD5AC06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.883 Expected Error Rate: 0.0280 Quality Trim Threshold: 14.5