Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E394607

Search information 
Request: 394607Match: SGN-E394607
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182738Clone name: TUS-40-F16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182738 is on microarray TOM1 spot ID 1-1-1.2.5.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C134191 [cTOD-8-F20] Trace: SGN-T143836 EST: SGN-E330762 Direction: 5' Facility: TIGR
Clone: SGN-C182738 [TUS-40-F16] Trace: SGN-T195932 EST: SGN-E394606 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394607Length: 259 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394607 [] (trimmed) GGCTCAAAAATGTATAAAATTCACAAAATAATGAGAAAAAAAAAAGAATAAAATAATTTTGTTCTTTTAATTAGCTTTGTAAGGAGTAGGTTTTG
GCATATCCTTAACTATGCCACATAATAAATCATTATCAGGCATGTTGTACTCATCTTTAATTGATTTATTTGGAAAAAGGACACTGAAATATAAT
TGATGTCCCAAATAATTTCTCTCCAATGAATTTGATCTTAAATTCCATAATCCAGCATTGTCAAGTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394607] SGN-U572539 Tomato 200607 Build 2 186 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195933 [Download][View] Facility Assigned ID: FA0AAD28DC08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.891 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5