EST details — SGN-E394188

Search information 
Request: 394188Match: SGN-E394188
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183454Clone name: TUS-42-D12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183454 is on microarray TOM1 spot ID 1-1-5.4.1.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183454 [TUS-42-D12] Trace: SGN-T194980 EST: SGN-E393654 Direction: 3' Facility: INRA
Clone: SGN-C183454 [TUS-42-D12] Trace: SGN-T194981 EST: SGN-E393655 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394188Length: 404 bp (902 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394188 [] (trimmed) AAAGGAATAAATATATGCTTTAGATTTCATTGCAGGATTCAGCGAAAACATGACAGCTCACGAGGCTTCCTCTCTGATGAAACAGAGTTCTTTAA
TTAGACAAAAGTTTAATATTGCTCACTGCATCATCTTCAACTGTAAAACACAACCAAACGAAATAATCCTAGTAAGCAAACTAGCTGAGGTTCTA
AATAAAGTTCAGTTCAGTCTCAAGCTTTCTTTGAAATGAGATCCTCAATCAGGTCTGCAGCATCTTGAATGGTTGCAATACTCTGAGCACTGTCT
TCTTCCACCGAAATGCCAAATTCTTCCACAAGTCCCATGAAAATCTCCACCGAATCAAGAAAATCACCACGCAACCGCAGCAAACTTTGAATCTC
CACAAACATAAATATCAGCAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394188] SGN-U590403 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195514 [Download][View] Facility Assigned ID: FA0AAD30DB06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0200 Quality Trim Threshold: 14.5